Información

10.9: Pasos de la transcripción: biología


Objetivos de aprendizaje

Comprender los pasos básicos en la transcripción de ADN en ARN.

El proceso de Transcripción tiene lugar en el citoplasma de los procariotas y en el núcleo de los eucariotas. Utiliza el ADN como plantilla para producir una molécula de ARN (ARNm). Durante la transcripción, se produce una hebra de ARNm que es complementaria a una hebra de ADN. La figura 1 muestra cómo ocurre esto. Eventualmente, porciones del ARNm transcrito se convertirán en proteínas funcionales.

También puede ver este video más detallado sobre la transcripción.

Pasos de la transcripción

La transcripción tiene lugar en tres pasos: inicio, alargamiento y terminación. Los pasos se ilustran en la Figura 2.

Paso 1: Iniciación

Iniciación es el comienzo de la transcripción. Ocurre cuando la enzima Polimerasa de ARN se une a una región de un gen llamado promotor. Esto le indica al ADN que se desenrolle para que la enzima pueda "leer" las bases en una de las cadenas de ADN. La enzima ahora está lista para hacer una cadena de ARNm con una secuencia complementaria de bases.

Paso 2: alargamiento

Alargamiento es la adición de nucleótidos a la cadena de ARNm. La ARN polimerasa lee la hebra de ADN desenrollada y construye la molécula de ARNm, utilizando pares de bases complementarios. Durante este proceso, una adenina (A) en el ADN se une a un uracilo (U) en el ARN.

Paso 3: Terminación

Terminación es el final de la transcripción, y ocurre cuando la ARN polimerasa cruza un secuencia de parada (terminación) en el gen. La hebra de ARNm está completa y se desprende del ADN.

Este video proporciona una revisión de estos pasos. Puede dejar de ver el video a las 5:35. (Después de este punto, se analiza la traducción, que discutiremos en el próximo resultado).

Se ha excluido un elemento de YouTube de esta versión del texto. Puede verlo en línea aquí: pb.libretexts.org/bionm1/?p=356

Visite esta animación de BioStudio para ver el proceso de transcripción procariota.

Se ha excluido un elemento de YouTube de esta versión del texto. Puede verlo en línea aquí: pb.libretexts.org/bionm1/?p=356


Pasos de la transcripción del ADN al ARN

  • Química
    • Bioquímica
    • Lo esencial
    • Leyes químicas
    • Moléculas
    • Tabla periódica
    • Proyectos y Experimentos
    • Método científico
    • Química Física
    • Química Médica
    • Química en la vida cotidiana
    • Químicos famosos
    • Actividades para niños
    • Abreviaturas y acrónimos
    • Ph.D., Ciencias Biomédicas, Universidad de Tennessee en Knoxville
    • Licenciatura en Física y Matemáticas, Hastings College

    El ADN o ácido desoxirribonucleico es la molécula que codifica la información genética. Sin embargo, el ADN no puede ordenar directamente a una célula que produzca proteínas. Tiene que ser transcrito en ARN o ácido ribonucleico. El ARN, a su vez, es traducido por maquinaria celular para producir aminoácidos, que se unen para formar polipéptidos y proteínas


    Proceso de transcripción de ARN | Genética

    El tRNA, mRNA y rRNA están involucrados en el proceso de transcripción. Sin embargo, se requiere una enzima transcriptasa, es decir, la ARN polimerasa dependiente de ADN para la síntesis de ARN mediante el uso de trifosfatos de ribonucleótidos, es decir, ATP, GTP, CTP y UTP. La estructura y función de la ARN polimerasa se describen a continuación.

    1. ARN polimerasa:

    En una plantilla de ADN, la elongación de la cadena de ARN en cada paso es catalizada por la ARN polimerasa. La ARN polimerasa se encuentra tanto en procariotas como en eucariotas, pero la estructura y función en estos dos grupos de organismos difieren.

    En los procariotas, una sola enzima, la ARN polimerasa, gobierna la síntesis de todos los ARN celulares, mientras que en los eucariotas, varios tipos de ARN polimerasas participan en la síntesis de un ARN celular. Por ejemplo, el ARNm, el ARNt y el ARNr en E. coli son sintetizados por la misma ARN polimerasa.

    La holoenzima es una ARN polimerasa completa que consta de un núcleo, una enzima y un factor sigma (σ), por lo que es una enzima compleja. La enzima central de E. coli consta de cinco cadenas polipeptídicas, dos subunidades α, una (β), una subunidad β & # 8217 y una subunidad omega (ω) (fig. 10.2). Hay siete cadenas polipeptídicas (p. Ej., Β αα δω1, ω2) en la enzima central de E. coli. La holoenzima se une al ADN en sitios específicos llamados promotores y transcribe una longitud específica de ARN.

    Por tanto, el factor o juega un papel importante en el reconocimiento del promotor por la ARN polimerasa. Puede aislarse fácilmente de la holoenzima. La subunidad β consta de un sitio catalítico para la síntesis de ARN y también sitios de unión para sustratos y productos. La subunidad β juega un papel en la unión de la ARN polimerasa al molde de ADN.

    Las dos subunidades a ensamblan las dos subunidades más grandes en la enzima central (α2ββ & # 8217ω). La función de la subunidad pequeña (ω) no se conoce en detalle, sin embargo, se supone que participa en el desenrollado. Las subunidades de la ADN polimerasa, los genes estructurales y sus funciones se resumen en la Tabla 10.1. La ARN polimerasa de E. coli sintetiza ARN a una velocidad de 40 nucleótidos por minuto a 37 ° C.

    (i) Tipos de ARN polimerasa:

    Hay tres polimerasas de ARN eucariotas diferentes que son transcritas por tres conjuntos diferentes de genes (fig. 10.3).

    Se distinguen por su sensibilidad a una toxina fúngica, α-amanitina:

    (a) ARN polimerasa I (ARN Pol I):

    Se encuentra en el nucleolo y sintetiza precursores de la mayoría de los ARNr. Es sensible a la α-amanitina.

    (B) ARN polimerasa II (ARN Pol II):

    Se localiza en el nucleoplasma y sintetiza precursores de ARNm y algunos ARN nucleares pequeños. Es muy sensible a la α-amanitina.

    (C) ARN polimerasa III (ARN Pol III):

    Está ubicado en el nucleoplasma. Sintetiza los precursores de tRNA, 5S rRNA y otros pequeños RNA nucleares y citoplasmáticos. Es moderadamente sensible a la α-amanitina.

    Además, un antibiótico rifampicina inhibe comúnmente la transcripción al interferir con la subunidad P de la ARN polimerasa procariota. Ishihawa (1992) ha presentado una visión actual de la estructura de la ARN polimerasa y algunos sitios de unión para cada subunidad (Fig. 10.4).

    Fig. 10.4: Mapa funcional de subunidades de ARN polimerasa.

    (ii) El sitio de la transcripción:

    La transcripción comienza en el sitio del promotor, es decir, el cistrón localizado en la molécula de ADN. De dos, solo se transcribe una hebra de dsDNA. También se ha demostrado que en ØX174 para cualquier cistrón solo se transcribe una hebra de ADN en ARN. Además, en el fago λ y el fago T4 se transcriben ambas cadenas, donde una cadena sirve como molde para algunos genes.

    El resto de genes se transcriben a partir de la otra hebra. La hebra de ADN que actúa como molde se conoce como hebra antisentido. Las secuencias de nucleótidos de la hebra antisentido y las transcripciones de ARNm son complementarias. La otra hebra se llama hebra sensorial. Las bases de la hebra con sentido y la del ARNm son exactamente las mismas.

    En algunos virus, p. Ej. SP8, ØX174, etc. de dos, solo se transcribe una hebra. En SV40, ambas cadenas se transcriben para genes diferentes. En contraste, en los fagos T even, el fago λ, E. coli y eucariotas, diferentes regiones de ambas cadenas de ADN actúan como molde para la síntesis de ARN.

    Tabla 10.1: Subunidades de ARN polimerasa y otros factores de transcripción.

    (iii) Proceso de transcripción:

    El proceso de transcripción se lleva a cabo en los siguientes tres pasos principales: inicio de cadena, alargamiento de cadena y terminación de cadena. El proceso completo de transcripción se describe en la figura 10.5.

    2. Iniciación en cadena:

    Durante el proceso de transcripción, los componentes necesarios para iniciar la cadena de ARN son los precursores activados por la plantilla, los iones metálicos divalentes (Mg ++ o Mn ++), la ARN polimerasa y la plantilla.

    (i) Reconocimiento del promotor:

    La enzima ARN polimerasa juega un papel clave en el reconocimiento y la unión del sitio de inicio. Antes de la formación de la enzima compleja, el factor sigma interactúa con la enzima central en el sitio de la subunidad p. Esto es necesario para verificar la transcripción de ambas cadenas por la enzima central. La holoenzima transcribe solo una de las dos cadenas de ADN. El factor sigma de la holoenzima reconoce la región promotora del ADN (figura 10.6).

    Una secuencia de bases específica (de 20 a 200 bases de longitud) se denomina promotor. El examen de un gran número de secuencias promotoras de diferentes genes de diferentes bacterias ha demostrado que tienen muchas características comunes. Las secuencias promotoras están centradas en -10 y -35 pares de bases desde el punto de inicio de la transcripción y están implicadas en la función promotora normal.

    E. coli tiene los siguientes dos componentes hexámeros distintos del promotor:

    La secuencia -10 se denomina cuadro de Pribnow & # 8217s, mientras que la región -35 se denomina sitio de reconocimiento. La caja de Pribnow & # 8217s se encuentra como parte de todos los promotores procariotas. La región -35 se encuentra a unos 35 pares de bases corriente arriba (lejos de la dirección del sitio de transcripción). El promotor está aguas arriba del gen estructural.

    La ARN polimerasa interactúa con grupos en el surco principal y reconoce la secuencia adecuada corriente arriba (región -35) de la caja de Pribnow & # 8217s, luego forma un complejo estable moviéndose lateralmente a la región -10. Por tanto, el factor sigma reconoce las dos regiones anteriores.

    (ii) Unión de la ARN polimerasa al promotor:

    La fuerza de unión de la ARN polimerasa a diferentes promotores varía. Hay algunos promotores que tienen sitios de unión para proteínas en lugar de ARN polimerasa.

    Por lo tanto, para estos promotores, el sitio debe estar ocupado por esa proteína para que la ARN polimerasa se una correctamente. Uno de los sitios de unión más comunes para este tipo es el que se une a un complejo de proteína receptora de AMP cíclica (CRP). La concentración de AMP gobierna la actividad de estos promotores.

    (iii) Desbobinado de ADN de doble hélice:

    La naturaleza súper helicoidal del cromosoma puede desempeñar un papel en la función promotora. Generalmente, un cromosoma superenrollado negativamente es una mejor plantilla transcripcional que un cromosoma relajado. La tensión de torsión impuesta por el súper enrollamiento hace que cierta área de ADN sea más fácil de separar por la ARN polimerasa.

    Por lo tanto, el superenrollamiento afecta la expresión de algunos genes más que de otros. La unión del factor omega (ω) de la ARN polimerasa da como resultado el desenrollamiento de una hélice de ADN. En consecuencia, se abre un segmento corto de ADN. A continuación, el complejo abierto permite la unión estrecha de la ARN polimerasa con el inicio posterior de la síntesis de ARN.

    (iv) Síntesis de la primera base de la cadena de ARN:

    La primera base de ARN sintetizada siempre está en forma de purina, es decir, guanina trifosfato (pppG) o adenina (pppA). La mayoría de las cadenas en E. coli se inicia con pppG, mientras que en el fago T7 y ØX174 se inicia con pppA. A diferencia de la replicación del ADN, el inicio de la síntesis de ARNm no requiere cebadores. La iniciación finaliza después de la formación del primer enlace entre nucleótidos (5 & # 8217pppPupN) (figura 10.5).

    3. Alargamiento de la cadena:

    El alargamiento de la cadena ocurre por la enzima central que se mueve a lo largo de la plantilla de ADN. Después de comenzar el alargamiento, la transcripción continúa a una velocidad de entre 30 y 60 nucleótidos por segundo a 37 ° C.

    En general, la reacción de alargamiento incluye los pasos:

    (i) Unión de nucleótidos trifosfato,

    (ii) Formación de enlaces entre el nucleótido y el 3 & # 8242-OH de la cadena de ARN naciente,

    (iii) Liberación de pirofosfato, y

    (iv) Translocación de polimerasa a lo largo de la plantilla de ADN.

    Los ribonucleótidos trifosfatos activados, es decir, ATP, UTP, OTP y CTP, se añaden de acuerdo con los nucleótidos de una hebra del molde de ADN. El nucleótido entrante forma enlaces de hidrógeno con una base de ADN. La reacción ocurre entre los nucleótidos en el extremo 3 & # 8242 de la molécula de ARN y P en el grupo trifosfato que conduce a la eliminación de fosfatos (PPi). El PPi pronto se hidroliza a fosfato inorgánico (Pi) (figura 10.7A).

    (I) Factor de liberación de Sigma (σ):

    Cuando se forma un transcrito de ARNm de 8-9 nucleótidos de longitud, el factor σ se libera abruptamente del complejo. En consecuencia, esto provoca una disminución en la afinidad de σ del complejo ARN polimerasa-ADN-ARN naciente. La liberación de σ puede combinarse con cualquier enzima central y, por lo tanto, se reutiliza para el inicio de una nueva cadena (figura 10.5).

    (ii) Dirección de transcripción:

    Los ribonucleótidos trifosfatos se unen al primer nucleótido de la plantilla y el crecimiento de la cadena tiene lugar en la dirección 5 & # 8242 → 3 & # 8242. La región de la plantilla que se ha transcrito recupera su forma de doble hélice detrás de la burbuja y la siguiente región de ADN que se va a transcribir se desenrolla.

    La transcripción de ARN no se alarga uniformemente a lo largo de la plantilla. Esto se debe a la presencia de sitios en pausa en determinadas regiones de la plantilla. Se ha encontrado que generalmente la secuencia de pausa contiene regiones ricas en GC de aproximadamente 16-20 pb, cadena arriba del extremo 3 & # 8242-OH del transcrito en pausa. Además, la región de simetría de la díada presente 16-20 pb aguas arriba del extremo 3 & # 8242 provoca una pausa. Sin embargo, el mecanismo de pausa no está claro.

    Además, se cree que después de la liberación del factor sigma, las proteínas NusA y NusG se asocian con la enzima central y modulan la velocidad de elongación. En algunos sitios, estas proteínas mejoran la pausa.

    Es interesante observar que el transcrito de ARN recién formado consiste en un grupo trifosfato en 5 & # 8242 y un grupo -OH libre en el extremo 3 & # 8242 (Fig. 10.7 B). Además, la transcripción de ARN es más grande que el gen estructural. La mayoría de los mensajes contienen un promotor, es decir, una región próxima del ARNm que se denomina secuencia líder, es decir, la región no traducida antes del comienzo de la traducción.

    (iii) Lectura de prueba de ARNm:

    La ARN polimerasa posee una actividad de corrección de pruebas que es análoga a la actividad exonucleasa 3 & # 8242 → 5 & # 8242 de la ADN polimerasa. Las dos proteínas, GreA y GreB permiten a la ARN polimerasa (que está detenida transcripcionalmente) respaldar y escindir 2-3 nucleótidos del extremo 3 & # 8242 del mensaje naciente. Esto da como resultado la liberación de ARN polimerasa que, a su vez, pasa por el punto de detención en el extremo 3 & # 8242 del gen.

    (iv) Interacción proteína-proteína con la ARN polimerasa:

    Hay varios factores reguladores que contactan directamente con la ARN polimerasa en la región promotora de la plantilla. Dichos factores reguladores (proteínas) se pueden dividir en dos clases, I y II.

    Las proteínas de clase I actúan como activadores de la transcripción. Estos se unen cadena arriba del promotor (por ejemplo, CRP, AraC, Fnr y OmpR). Los factores de transcripción de clase II se superponen a la región promotora; algunos de estos reguladores entran en contacto con el extremo C-terminal de la subunidad α (fig. 10.4).

    4. Terminación de la cadena:

    El proceso de terminación de la cadena de ARN finaliza con los eventos:

    (i) Cese del alargamiento,

    (ii) Liberación de la transcripción del complejo terciario, y

    (iii) Disociación de la polimerasa del molde de ADN.

    Hay dos tipos de mecanismos que provocan la terminación: terminaciones rho-independientes y rho-dependientes.

    (i) Terminación independiente de Rho:

    La señal de terminación independiente de rho es reconocida por el propio ADN. Consiste en una región rica en GC con simetría de díadas. La ARN polimerasa lee y extiende la secuencia de poliA en la plantilla de ADN (figura 10.8A). Sintetiza un transcrito de ARN que se pliega para formar una estructura de tallo y bucle de aproximadamente 20 bases corriente arriba del extremo 3 & # 8242-OH con un tramo terminal de 4-8 poli U resi & shydues (figura 10.8B).

    Esta estructura de tallo-bucle de ARN hace que la ARN polimerasa se detenga e interrumpa el híbrido ARN-ADN en el extremo 5 & # 8242. Los residuos de poli U están presentes en el extremo 3 & # 8242 de la molécula híbrida de ARN-ADN. Los pares de bases híbridos U-A son relativamente inestables, por lo tanto, hace que el extremo 3 & # 8242 del híbrido se rompa y libere la cadena de ARNm.

    (ii) Terminación dependiente de Rho:

    Richardson (1983) ha proporcionado un modelo para la terminación de la cadena de ARN dependiente de rho (figura 10.9). La terminación dependiente de Rho requiere la proteína Rho (factor) codificada por el gen rho. El factor rho es un hexámero.

    Cuando un sitio de pausa fuerte aparentemente se encuentra a una distancia específica de una región promotora, se produce la terminación asociada con el factor rho. Sin embargo, debe quedar claro que un sitio de pausa fuerte presente cerca del promotor no actuará como sitio de terminación. Rho requiere ssRNA como región de unión (fig. 10.9 A).

    Fig. 10.9: Un modelo para la liberación de la cadena de ARN mediada por el factor Rho.

    El factor Rho se mueve a lo largo del ARN desde su sitio de unión hasta la enzima ARN polimerasa. El movimiento se ve facilitado por la hidrólisis de ATP que aporta energía. Con suerte, el ssRNA se enrolla alrededor del factor rho en el sitio de unión grande. Este paso precede a la llegada de la ARN polimerasa al sitio de terminación (B).

    La ARN polimerasa está envuelta parcialmente alrededor del factor Rho. En consecuencia, la proteína Rho entra en contacto con la enzima central de la polimerasa. Este contacto es facilitado por proteínas NusA o NusG. Este paso depende de la hidrólisis de nucleótidos trifosfatos (C).

    El proceso de envoltura continúa continuamente y rompe los enlaces no covalentes que mantienen el ARN recién formado con la ADN y la ARN polimerasa. La activación de una actividad helicasa de ARN / ADN hace que la cadena de ARNm y la ARN polimerasa del núcleo se disocien de la plantilla de ADN. Así, el complejo Rho-proteína-ARN se libera del complejo ARN polimerasa-ADN (D).

    Finalmente, la ARN polimerasa central se libera e interactúa con el factor sigma que se usa para el inicio de la segunda ronda de transcripción. También se ha descrito una señal de terminación de la transcripción dependiente de rho en el bacteriófago F1 por Mose y Model (1984).

    5. Rotación de ARN:

    Sobre la base de las tasas de desintegración, el ARN transcrito de esta manera in vivo se puede agrupar en dos: moléculas de ARN estables e inestables. Las moléculas de ARN estable consisten en ARNt y ARNr, mientras que los ARNm son inestables. En E. coli, la población total de ARNt y ARNr es del 15-25% y del 70-80%, respectivamente.

    El ARNm está presente solo en una pequeña cantidad (3-5%). Las razones de la estabilidad son la asociación de rRNA en complejos de ribonucleoproteínas (ribosoma) y la conversión de tRNA y rRNA en la estructura secundaria.

    Esta conversión protege los ARN estables en el extremo 3 & # 8242 de la disolución de las ribonucleasas. Las exonucleasas celulares degradan el ARNm en la dirección 3 '→ 5'. Sin embargo, la presencia de una estructura de tallo-bucle posiblemente inhibe la asociación de endonucleasas.


    10.9: Pasos de la transcripción: biología

    La transcripción es el proceso mediante el cual se sintetiza un ARN monocatenario a partir del ADN. De otra forma, la transferencia de información genética del ADN al ARN se denomina transcripción. En este proceso, una hebra de ADN llamada plantilla de ADN da lugar a una nueva hebra de ARN. También se llama síntesis de ARN.

    Requisitos básicos para la transcripción:

    1) Plantilla de ADNUna sola hebra de ADN actúa como plantilla para dirigir la formación de ARN complementario durante la transcripción. En la síntesis de ARN, solo una hebra de ADN transcribe ARN.

    2) SustratosLos sustratos para la síntesis de ARN son los cuatro ribonucleósidos trifosfatos: trifosfato de adenosina (rATP), trifosfato de guanosina (rGTP), trifosfato de citidina (eCTP) y trifosfato de uridina (rUTP). La escisión del enlace fosfato de alta energía entre el alfa y los fosfatos proporciona la energía para la adición de nucleótidos a la cadena de ARN en crecimiento.

    3) EnzimasEn eucariotas, hay tres tipos de ARN polimerasas responsables de la síntesis de los tres tipos de ARN (ARNm, ARNr y ARNt). En procariotas, solo una ARN polimerasa sintetiza los tres tipos de ARN.

    a) ARN polimerasa I: responsable de la síntesis de ARNr.

    b) ARN polimerasa II- responsable de la síntesis de ARNm.

    c) ARN polimerasa III: responsable de la síntesis de ARNt.

    4) Promotor-Las secuencias promotoras son responsables de dirigir la ARN polimerasa para iniciar la transcripción en un punto particular. El factor sigma (& sigma) reconoce la señal de inicio o la región promotora del ADN. De manera similar, se requiere un factor de terminación llamado factor Rho (& rho) para la terminación de la región de terminación.

    Proceso de transcripción:

    El proceso de transcripción es similar al de la replicación del ADN. Requiere una región promotora y una región terminadora. Se completa en tres pasos:

    1)Iniciación:

    Es el comienzo de la síntesis de la hebra de ARN. Este proceso implica:

    & bull Durante la replicación, la ARN polimerasa se une a una región específica de ADN conocida como región promotora. En procariotas, requiere un factor sigma (& sigma) de iniciación que reconozca la señal de inicio o la región promotora del ADN. El complejo RNA polimerasa-sigma se une a la región promotora e inicia la transcripción.

    & bull Por la acción del complejo RNA polimerasa-sigma, dos hebras de DNA se desenrollan o desenrollan y se separan en un punto específico. (No se requiere cebador para la síntesis de ARN).

    fuente: www.mun.ca fig: Transcripción

    2) Alargamiento:

    Es el paso de formación de la hebra de ARN. Implica:

    A medida que la cadena de ADN se desenrolla, ambas cadenas de ADN se separan. Entre dos hebras de ADN, la hebra 3'-5 'actúa como molde o hebra maestra para la formación de ARN, mientras que otra hebra (5'-3') permanece inactiva o no participa, por lo que se denomina hebra antisentido.

    & bullTemplate o hebra maestra tiene un sitio promotor o de iniciación y un sitio terminador. La síntesis de ARN comienza en el sitio del promotor y termina en el sitio del terminador.

    La formación de una nueva cadena de ribonucleótidos procede mediante la adición de nuevas bases. El apareamiento de bases se produce sobre la base de su especificidad [A se empareja con U y C con G] en la hebra de ADN molde. Estas bases permanecen disponibles en el nucleoplasma en forma de ATP, CTP, UTP y GTP. Este proceso de polimerización es catalizado por una enzima conocida como ARN polimerasa dependiente de ADN.

    & toro La ARN polimerasa avanza progresivamente y progresa en la formación de la cadena de ARN. Cuando la ARN polimerasa llega al sitio de terminación, desencadena el final de la transcripción.

    3) Terminación:

    Es el último paso de la transcripción. Significa el final de la transcripción. Implica:

    & bull La síntesis de ARN finaliza tan pronto como la ARN polimerasa alcanza el sitio de terminación.

    & bull Cuando termina la transcripción, las hebras de ADN se rebobinan. El ARN recién formado se llama transcripción y el proceso se llama transcripción.

    & bullRNA no permanecen conectados con la plantilla de ADN, sino que se separan como una sola hebra y se mueven fuera del núcleo a través del poro nuclear hacia el citoplasma.

    & bull Se liberan varias copias de las transcripciones de ARN de cada molde de ADN.

    Así, se completa el proceso de síntesis de ARN.

    Keshari, Arvind K. y Kamal K. Adhikari. Un libro de texto de biología secundaria superior (clase XII). 1er. Katmandú: Vidyarthi Pustak Bhandar, 2015.

    Mehta, Krishna Ram. Principio de biología. 2ª edición. Katmandú: Asmita, 2068,2069.

    Jorden, S.L. principio de biología. 2ª edición. Katmandú: publicación del libro Asmita, 2068.2069.

    Affordances food-truck SpaceTeam unicorn disrupt integrar par viral programación big data pitch deck intuitivo prototipo intuitivo long shadow. Hacker receptivo intuitivo

    Jacob Sims

    Prototipo intuitivo, intuitivo, líder de pensamiento, personas, paradigma de paralaje, larga sombra, atractivo, unicornio, SpaceTeam, fondo, idea, paradigma.

    Kelly Dewitt

    La cascada intuitiva impulsada del hacker receptivo es tan 2000 y el cortado intuitivo tardío que arranca el capital de riesgo. El atractivo camión de comida integra la programación intuitiva de pares Steve Jobs, el diseño centrado en el ser humano, pensador-creador-hacedor.

    Affordances food-truck SpaceTeam unicorn disrupt integrar par viral programación big data pitch deck intuitivo prototipo intuitivo long shadow. Hacker receptivo intuitivo

    Luke Smith

    Unicorn disrupt integra par viral programación big data pitch deck intuitivo prototipo intuitivo long shadow. Hacker receptivo intuitivo

    Deja un comentario :
    Cosas para recordar
    • La transferencia de información genética del ADN al ARN se llama transcripción.
    • Varios requisitos son esenciales para la síntesis de ARN.
    • El proceso de transcripción es similar al de la replicación del ADN. Requiere una región promotora y una región terminadora. Se completa en tres pasos: inicio, alargamiento y terminación.
    • Incluye todas las relaciones que se establezcan entre las personas.
    • Puede haber más de una comunidad en una sociedad. Comunidad más pequeña que la sociedad.
    • Es una red de relaciones sociales que no se puede ver ni tocar.
    • Los intereses y objetivos comunes no son necesarios para la sociedad.

    Manténgase conectado con Kullabs. Puede encontrarnos en casi todas las plataformas de redes sociales.


    Bioquímica de modificadores de cromatina

    Dos elegantes estudios bioquímicos revelaron cómo la lectura de múltiples nucleosomas afecta a la cromatina. Bing Li (UT Southwestern, EE. UU.) Y Geeta Narlikar (UC San Francisco, EE. UU.) Utilizaron sustratos de dinucleosoma para investigar cómo el estado de modificación de un nucleosoma afecta la modificación de otro. Bing Li presentó un modelo intrigante en el que el reconocimiento de un dinucleosoma y su espaciamiento contribuye al control de la desacetilasa Rpd3 en la levadura. Narlikar presentó un mecanismo exquisito de cómo múltiples proteínas que contienen cromodominio colaboran para formar, mantener o expandir la heterocromatina represiva utilizando diferentes factores (HP1 y Suv39 / Clr4). Ella demostró que a pesar de reconocer el mismo residuo metilado en los nucleosomas (histona 3 lisina 9 H3K9), las preferencias diferenciales por los estados di- en contraposición a los estados trimetilo permitieron que los factores colaboraran en lugar de competir. Es probable que más interacciones entre nucleosomas modificados de manera diferente y proteínas accesorias revelen un nivel de regulación de la transcripción desconcertante tanto en su sutileza como en su complejidad.


    Describe el proceso de transcripción.

    La transcripción es el proceso de transcribiendo el código de ADN en otro tipo de código o mensaje: ARNm (ARN mensajero).

    Una enzima llamada Polimerasa de ARN se une a una parte específica de una secuencia de ADN llamada promotor (esto actúa como una señal para que la célula comience la transcripción). Luego, el ADN debe descomprimirse y desenrollarse para exponer las dos hebras de ADN.

    Una hebra, que contiene bases complementarias a la del gen que necesita ser transcrito, actúa como plantilla - a través del emparejamiento de bases complementarias, los nucleótidos se alinean junto con la hebra molde (A con U, G con C), formando una molécula de ARNm monocatenario.

    Cuando la ARN polimerasa reconoce que ha alcanzado un secuencia de terminador o codón de parada (el final de la secuencia que codifica ese gen específico), el ARNm se desprende del ADN. El ADN se rebobina detrás de la ARN polimerasa a medida que se trasloca (se mueve) a través de la hebra de ADN.

    Luego, la molécula de ARNm sale del núcleo, a través de un poro nuclear, hacia el citoplasma, lista para ser traducida a una proteína en el sitio de un ribosoma.


    1) Introducción

    Como saben, el ADN es el material genético de casi todos los objetos vivos. Almacenaba información genética en forma de secuencias de nucleótidos.

    Esta información almacenada solo se vuelve útil cuando se expresa en la producción de ARN y proteínas (se puede decir que transcripción y traducción).

    Puede considerar que la función principal del ADN es almacenar información genética durante mucho tiempo. Pero el ARN es la única molécula que actúa como almacenamiento y transición de información en actividad catalítica. Porque algunos virus de ARN tienen ARN como material genético.


    Transcripción y traducción de biología

    La definición de traducción. La biología molecular y la genética de la biología proporcionan la siguiente definición de traducción en biología. Traducción significa el proceso de traducir una secuencia de ARNm (ARN mensajero) en aminoácidos. Como la mayoría de las células están formadas por proteínas, la traducción del ADN es un proceso fundamental para la creación de células.

    Fases de la traducción

    Algunas personas afirman que hay cuatro fases de traducción: iniciación, alargamiento, translocación y terminación. Sin embargo, la mayoría de los científicos creen que solo hay tres pasos de traducción en biología. Las mismas nociones se utilizan en el proceso de transcripción para describir el proceso de fabricación de la cadena de ARNm. La diferencia es que en la traducción se crea la cadena de polipéptidos. Echemos un vistazo más de cerca a estos pasos.

    En esta fase, el ARNt, el ARNm y el aminoácido se combinan en un ribosoma. El ARNt se une al codón de inicio, que es el conjunto de tres nucleótidos que comienza la secuencia codificada de un gen y especifica el aminoácido metionina. La metionina ingresa al ribosoma uniéndose al ARNt con el anticodón correcto. El codón de inicio es AUG. UAC es su anticodón. Si no sabe acerca de esto, debe prestar atención a las reglas del emparejamiento de bases complementarias. Cuando el tRNA se une al codón AUG, la metionina se une al tRNA.

    A medida que se crean enlaces peptídicos, aparecen más aminoácidos. Su cadena se vuelve más larga. Por tanto, se forma un polipéptido. Un ARNt y el aminoácido ingresan al ribosoma. Si el anticodón coincide con el codón del ARNm, el ribosoma unirá dos aminoácidos. Si no lo hacen, se rechaza el aminoácido incorrecto. Al vincular los aminoácidos, el ribosoma los mueve hacia adelante. El procedimiento se repite cuando el siguiente par del ARNt y el aminoácido ingresa al ribosoma.

    Si el ribosoma alcanza uno de los tres codones de terminación, no tendrá un ARNt correspondiente. Por tanto, las proteínas estimularán la liberación de la cadena polipeptídica. Los factores de liberación de proteínas reconocen los codones de terminación solo cuando aparecen en el sitio A. El sitio A se llama así porque se une solo al aminoacil-tRNA entrante (el tRNA que trae el siguiente aminoácido). El ribosoma se libera del ARNm. Sus subunidades se disocian. Los pequeños se conectarán con las nuevas combinaciones de ARNt y metionina. Comenzará una nueva traducción.

    Por tanto, podemos llegar a la conclusión de que hay dos pasos en la expresión génica: transcripción y traducción. La transcripción es la codificación de la información del ADN en moléculas de ARN. La traducción es la codificación de información de nucleótidos de ARNm en una secuencia de aminoácidos en una proteína.

    En cuanto a los eucariotas, la transcripción y la traducción están separadas en el tiempo. También tienen lugar en diferentes lugares. El proceso de transcripción del ADN en ARNm tiene lugar en el núcleo. El proceso de traducción de ARNm en polipéptidos ocurre en polisomas en el citoplasma. Como las bacterias no tienen núcleo, los procesos de traducción y transcripción ocurren simultáneamente.

    Para comprender mejor la información, consulte las siguientes fuentes:

    Asegúrese de poder responder las siguientes preguntas. Si no es así, lea esta información una vez más u obtenga ayuda profesional de los mejores tutores de biología.


    Biología 171

    Al final de esta sección, podrá hacer lo siguiente:

    • Enumere los diferentes pasos de la transcripción procariota
    • Discutir el papel de los promotores en la transcripción procariota.
    • Describir cómo y cuándo finaliza la transcripción.

    Los procariotas, que incluyen bacterias y arqueas, son en su mayoría organismos unicelulares que, por definición, carecen de núcleos unidos a la membrana y otros orgánulos. Un cromosoma bacteriano es un círculo cerrado que, a diferencia de los cromosomas eucariotas, no está organizado alrededor de proteínas histonas. La región central de la célula en la que reside el ADN procariótico se denomina región nucleoide. Además, los procariotas suelen tener abundantes plásmidos, que son moléculas de ADN circulares más cortas que pueden contener solo uno o unos pocos genes. Los plásmidos se pueden transferir independientemente del cromosoma bacteriano durante la división celular y, a menudo, portan rasgos como los relacionados con la resistencia a los antibióticos.

    La transcripción en procariotas (y en eucariotas) requiere que la doble hélice de ADN se desenrolle parcialmente en la región de síntesis de ARNm. La región de desenrollado se llama burbuja de transcripción. La transcripción siempre procede de la misma hebra de ADN para cada gen, que se denomina hebra plantilla. El producto de ARNm es complementario a la hebra molde y es casi idéntico a la otra hebra de ADN, denominada hebra sin plantilla o hebra codificante. La única diferencia de nucleótidos es que en el ARNm, todos los nucleótidos T se reemplazan con nucleótidos U ((Figura)). En una doble hélice de ARN, A puede unirse a U a través de dos enlaces de hidrógeno, al igual que en el apareamiento A – T en una doble hélice de ADN.


    El par de nucleótidos en la doble hélice de ADN que corresponde al sitio desde el cual se transcribe el primer nucleótido de ARNm 5 & # 8242 se denomina sitio +1, o sitio de iniciación. Los nucleótidos que preceden al sitio de inicio se indican con un "-" y se designan nucleótidos aguas arriba. Por el contrario, los nucleótidos que siguen al sitio de inicio se indican con una numeración "+" y se denominan nucleótidos corriente abajo.

    Inicio de la transcripción en procariotas

    Los procariotas no tienen núcleos encerrados en membranas. Por lo tanto, los procesos de transcripción, traducción y degradación del ARNm pueden ocurrir simultáneamente. El nivel intracelular de una proteína bacteriana se puede amplificar rápidamente mediante múltiples eventos de transcripción y traducción que ocurren simultáneamente en la misma plantilla de ADN. Los genomas procariotas son muy compactos y las transcripciones procariotas a menudo cubren más de un gen o cistrón (una secuencia codificante de una sola proteína). Luego, los ARNm policistrónicos se traducen para producir más de un tipo de proteína.

    Nuestra discusión aquí ejemplificará la transcripción al describir este proceso en Escherichia coli, una especie eubacteriana bien estudiada. Aunque existen algunas diferencias entre la transcripción en E. coli y transcripción en arqueas, una comprensión de E. coli la transcripción se puede aplicar a prácticamente todas las especies bacterianas.

    ARN polimerasa procariota

    Los procariotas usan la misma ARN polimerasa para transcribir todos sus genes. En E. coli, la polimerasa está compuesta por cinco subunidades polipeptídicas, dos de las cuales son idénticas. Cuatro de estas subunidades, denotadas α, α, β, y β‘, comprise the polymerase core enzyme . These subunits assemble every time a gene is transcribed, and they disassemble once transcription is complete. Each subunit has a unique role the two α-subunits are necessary to assemble the polymerase on the DNA the β-subunit binds to the ribonucleoside triphosphate that will become part of the nascent mRNA molecule and the β‘ subunit binds the DNA template strand. The fifth subunit, σ, is involved only in transcription initiation. It confers transcriptional specificity such that the polymerase begins to synthesize mRNA from an appropriate initiation site. Sin σ, the core enzyme would transcribe from random sites and would produce mRNA molecules that specified protein gibberish. The polymerase comprised of all five subunits is called the holoenzyme .

    Prokaryotic Promoters

    A promoter is a DNA sequence onto which the transcription machinery, including RNA polymerase, binds and initiates transcription. In most cases, promoters exist upstream of the genes they regulate. The specific sequence of a promoter is very important because it determines whether the corresponding gene is transcribed all the time, some of the time, or infrequently. Although promoters vary among prokaryotic genomes, a few elements are evolutionarily conserved in many species. At the -10 and -35 regions upstream of the initiation site, there are two promoter consensus sequences, or regions that are similar across all promoters and across various bacterial species ((Figure)). The -10 sequence, called the -10 region, has the consensus sequence TATAAT. The -35 sequence has the consensus sequence TTGACA. These consensus sequences are recognized and bound by σ. Once this interaction is made, the subunits of the core enzyme bind to the site. The A–T-rich -10 region facilitates unwinding of the DNA template, and several phosphodiester bonds are made. The transcription initiation phase ends with the production of abortive transcripts, which are polymers of approximately 10 nucleotides that are made and released.


    View Transcription (video – Walter & Eliza Hall) to see the first part of transcription and the base sequence repetition of the TATA box.

    Elongation and Termination in Prokaryotes

    The transcription elongation phase begins with the release of the σ subunit from the polymerase. The dissociation of σ allows the core enzyme to proceed along the DNA template, synthesizing mRNA in the 5′ to 3′ direction at a rate of approximately 40 nucleotides per second. As elongation proceeds, the DNA is continuously unwound ahead of the core enzyme and rewound behind it. The base pairing between DNA and RNA is not stable enough to maintain the stability of the mRNA synthesis components. Instead, the RNA polymerase acts as a stable linker between the DNA template and the nascent RNA strands to ensure that elongation is not interrupted prematurely.

    Prokaryotic Termination Signals

    Once a gene is transcribed, the prokaryotic polymerase needs to be instructed to dissociate from the DNA template and liberate the newly made mRNA. Depending on the gene being transcribed, there are two kinds of termination signals. One is protein-based and the other is RNA-based. Rho-dependent termination is controlled by the rho protein, which tracks along behind the polymerase on the growing mRNA chain. Near the end of the gene, the polymerase encounters a run of G nucleotides on the DNA template and it stalls. As a result, the rho protein collides with the polymerase. The interaction with rho releases the mRNA from the transcription bubble.

    Rho-independent termination is controlled by specific sequences in the DNA template strand. As the polymerase nears the end of the gene being transcribed, it encounters a region rich in C–G nucleotides. The mRNA folds back on itself, and the complementary C–G nucleotides bind together. The result is a stable hairpin that causes the polymerase to stall as soon as it begins to transcribe a region rich in A–T nucleotides. The complementary U–A region of the mRNA transcript forms only a weak interaction with the template DNA. This, coupled with the stalled polymerase, induces enough instability for the core enzyme to break away and liberate the new mRNA transcript.

    Upon termination, the process of transcription is complete. By the time termination occurs, the prokaryotic transcript would already have been used to begin synthesis of numerous copies of the encoded protein because these processes can occur concurrently. The unification of transcription, translation, and even mRNA degradation is possible because all of these processes occur in the same 5′ to 3′ direction, and because there is no membranous compartmentalization in the prokaryotic cell ((Figure)). In contrast, the presence of a nucleus in eukaryotic cells precludes simultaneous transcription and translation.


    View Transcription (video – ndsuvirtualcell) to see the process of prokaryotic transcription.

    Resumen de la sección

    In prokaryotes, mRNA synthesis is initiated at a promoter sequence on the DNA template comprising two consensus sequences that recruit RNA polymerase. The prokaryotic polymerase consists of a core enzyme of four protein subunits and a σ protein that assists only with initiation. Elongation synthesizes mRNA in the 5′ to 3′ direction at a rate of 40 nucleotides per second. Termination liberates the mRNA and occurs either by rho protein interaction or by the formation of an mRNA hairpin.

    Respuesta libre

    If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?

    DNA is different from RNA in that T nucleotides in DNA are replaced with U nucleotides in RNA. Therefore, they could never be identical in base sequence.

    In your own words, describe the difference between rho-dependent and rho-independent termination of transcription in prokaryotes.

    Rho-dependent termination is controlled by the rho protein, which tracks along behind the polymerase on the growing mRNA chain. Near the end of the gene, the polymerase stalls at a run of G nucleotides on the DNA template. The rho protein collides with the polymerase and releases mRNA from the transcription bubble. Rho-independent termination is controlled by specific sequences in the DNA template strand. As the polymerase nears the end of the gene being transcribed, it encounters a region rich in C–G nucleotides. This creates an mRNA hairpin that causes the polymerase to stall right as it begins to transcribe a region rich in A–T nucleotides. Because A–U bonds are less thermostable, the core enzyme falls away.

    A fragment of bacterial DNA reads:

    3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’

    Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

    By examining the DNA sequence, we can see that there is a -10 consensus sequence near the 3’ end of the fragment. If we then count downstream, the +1 initiation site is the T immediately following the sequence AAT. This means the DNA fragment that will serve as the template for transcription has the sequence TGATAGAAGCACTCTAC. The mRNA made from this template will have complimentary base pairing with uracil (U) instead of thymine (T). This gives us ACUAUCUUCGUGAGAUG as the transcribed mRNA sequence.

    Glosario


    Ver el vídeo: Transcripción del ADN (Enero 2022).